View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21326_low_34 (Length: 230)
Name: NF21326_low_34
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21326_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 209
Target Start/End: Complemental strand, 31303067 - 31302874
Alignment:
| Q |
20 |
aggggaaattgagatagaaaaataagagaaaggtata----cgtgatacatgctctggtagaaatggaagagaggcagaaagaagtacaagtattatatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31303067 |
aggggaaattgagatagaaaaataagacaaaggtatatagacgtgatacatgctctggtagaaatggaagagagacagaaagaagtacaagtattatatg |
31302968 |
T |
 |
| Q |
116 |
ctcctttaggctttggacggtatatccttttcttctagtagcatctttttgacttgtgttatctaaagacaaaattttaggcacaatatgtgac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31302967 |
ctcctttaggctttggacggtatatccttttcttctagtagcatctttttgacttgtgttatctaaagacaaaattttaggcacagtatgtgac |
31302874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University