View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21326_low_36 (Length: 216)
Name: NF21326_low_36
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21326_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 21415739 - 21415553
Alignment:
| Q |
15 |
agatgaaaagcaaaagtgaacagcgtgtaagcagctcattcactacttccaccagttccatattctgttctcgtgggcctctctggtcccgtccgtacac |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21415739 |
agatgaaaagcaaaagggaacagcgtgtaagcagctcattcactacttccaccagttccatattctgttctcgtgggcctctctggtcccgtccgtacac |
21415640 |
T |
|
| Q |
115 |
tttcttcaattaattctgcaactccaacgttgcccttcaccttcatgcccgcgtgacactccacaccctctgtcagtcattgtctct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21415639 |
tttcttcaattaattctgcaactccaacgttgcccttcaccttcatgcccgcgtgacactcctcaccctctgtcagtcattgtctct |
21415553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University