View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21326_low_38 (Length: 209)

Name: NF21326_low_38
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21326_low_38
NF21326_low_38
[»] chr2 (1 HSPs)
chr2 (22-196)||(32531947-32532122)


Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 22 - 196
Target Start/End: Complemental strand, 32532122 - 32531947
Alignment:
22 aggtcattattgacacacgtgctattggggatagtaagggccctacaactctttctgtcaattttttatgacagtttctgctaattattttagagccata 121  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32532122 aggtcattattgacacacgtgctattggggatggtaagggccctacaactctttctgtcaattttttatgacagtttctgctaattattttagagccata 32532023  T
122 atgatggatatcagattttgggacccacagaacacagatagag-aacataacatagaacaatcagattcctccaca 196  Q
    |||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||    
32532022 atgatggatatcagattttgggacccacagaacacaaagagagaaacataacatagaacaatcagattcctccaca 32531947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University