View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21326_low_4 (Length: 492)
Name: NF21326_low_4
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21326_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 19 - 377
Target Start/End: Complemental strand, 54913211 - 54912852
Alignment:
| Q |
19 |
acggtggcggcaaagtttgcgtttttcccgccggagccaccaacatacgaagtttacaaagagaacgatgatggggtgttgaagatttccggcacgacgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54913211 |
acggtggcggcaaagtttgcgtttttcccgccggagccaccaacatacgaagtttacaaagagaacgatgatggggtgttgaagatttccggcacgacgg |
54913112 |
T |
 |
| Q |
119 |
ataaaagcgtcgacgttcatattgtagacacaaaaggaggcaataagatcgttgctacgttgtggaaacacccttttgcaaggtttactgtattgtactc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54913111 |
ataaaagcgtcgacgttcatattgtagacacaaaaggaggcaataagatcgttgctacgttgtggaaacacccttttgcaaggtttactatattgtactc |
54913012 |
T |
 |
| Q |
219 |
tcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttagagctcatcttcgtgtcaatatcatgaggtttcttttcttaat-cct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54913011 |
tcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttagagctcatcttcgtgtcaatatcatgaggtttcttttcttaatccct |
54912912 |
T |
 |
| Q |
318 |
tatatacaattttgcatgcttttattaatacaacagtttttgtctgttaattaataatta |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54912911 |
tatatacaattttgcatgcttttattaatacaacagtttttgtctgttaattaataatta |
54912852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 214 - 272
Target Start/End: Complemental strand, 11464742 - 11464684
Alignment:
| Q |
214 |
tactctcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttag |
272 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||| ||| || |||||||||||||| |
|
|
| T |
11464742 |
tactctcatggcaacgctgctgatctgggtcagatgtatgagcttttcattgagcttag |
11464684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 217 - 249
Target Start/End: Complemental strand, 7338093 - 7338061
Alignment:
| Q |
217 |
tctcatggtaatgctgctgatttgggtcagatg |
249 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
7338093 |
tctcatggaaatgctgctgatttgggtcagatg |
7338061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University