View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21327_high_8 (Length: 352)

Name: NF21327_high_8
Description: NF21327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21327_high_8
NF21327_high_8
[»] scaffold0356 (1 HSPs)
scaffold0356 (10-332)||(11261-11583)
[»] chr8 (1 HSPs)
chr8 (13-332)||(19739578-19739897)
[»] scaffold0075 (1 HSPs)
scaffold0075 (170-240)||(48730-48800)
[»] chr6 (2 HSPs)
chr6 (169-227)||(15144206-15144264)
chr6 (170-245)||(15157214-15157289)
[»] chr4 (1 HSPs)
chr4 (170-240)||(9007-9077)
[»] chr7 (1 HSPs)
chr7 (170-245)||(12161203-12161278)
[»] scaffold0416 (1 HSPs)
scaffold0416 (169-234)||(12499-12564)
[»] scaffold0114 (1 HSPs)
scaffold0114 (144-212)||(5155-5223)
[»] chr1 (1 HSPs)
chr1 (202-234)||(8636213-8636245)


Alignment Details
Target: scaffold0356 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: scaffold0356
Description:

Target: scaffold0356; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 10 - 332
Target Start/End: Original strand, 11261 - 11583
Alignment:
10 gcaaaggcattcgatacgttagattggaattttcttcttgcggtgcttcagcggtttggttttgatgaaaaatttgtgcattggattttggtgattttgc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11261 gcaaaggcattcgatacgttagattggaattttcttcttgcggtgcttcagcggtttggttttgatgaaaaatttgtgcattggattttggtgattttgc 11360  T
110 attccgctcgtttatcaatattggttaatgggaaggctgttgggttcttttcatgttcgcgtggtgttcgccaaggagacccattgtcaccgcttctttt 209  Q
    | ||||||||||||||| | |||||||||||||| || |||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||||||    
11361 aatccgctcgtttatcagtcttggttaatgggaaagccgttgggttctttacttgttcgcatggtgttcgccaaggagacccattgtcaccgcttctttt 11460  T
210 ttgtctagctgaagaggttcttagtcgggctctttccatggctgcgattgacggacaactcattccaatgtcctattgccgcggagtctctttccccgct 309  Q
    |||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| || ||||| ||||||||| ||    
11461 ttgtctagttgaagaggttcttagtcgggcgctttccatggctgcgactgacggacaactcattccaatgtcctattgtcgtggagtatctttccccact 11560  T
310 catattttatacgctgatgatgt 332  Q
    |||||||||||||||||||||||    
11561 catattttatacgctgatgatgt 11583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 13 - 332
Target Start/End: Original strand, 19739578 - 19739897
Alignment:
13 aaggcattcgatacgttagattggaattttcttcttgcggtgcttcagcggtttggttttgatgaaaaatttgtgcattggattttggtgattttgcatt 112  Q
    ||||| |||||||| |||||||||||||| ||| ||  ||| |||| ||||||||||||| |||||||| ||||||||||||| |||||||||||| | |    
19739578 aaggctttcgataccttagattggaatttccttattttggttcttcggcggtttggttttcatgaaaaaattgtgcattggatcttggtgattttgaaat 19739677  T
113 ccgctcgtttatcaatattggttaatgggaaggctgttgggttcttttcatgttcgcgtggtgttcgccaaggagacccattgtcaccgcttcttttttg 212  Q
    | || ||||||||| | |||||||||||||| ||||||||||| ||||| || ||| |||| ||||| |||||| |||||||||| || ||||| || ||    
19739678 cagcccgtttatcagtgttggttaatgggaaagctgttgggtttttttcttgctcgggtggggttcgacaaggacacccattgtcccctcttctcttctg 19739777  T
213 tctagctgaagaggttcttagtcgggctctttccatggctgcgattgacggacaactcattccaatgtcctattgccgcggagtctctttccccgctcat 312  Q
    ||| ||||||||||||||||||||||| || ||||| ||| | | |  ||||| |||||  |||||||| ||||| || || |||||| | ||| ||||     
19739778 tctggctgaagaggttcttagtcgggcactctccattgcttcaactttcggacgactcacaccaatgtcttattgtcgtggggtctctcttcccactcag 19739877  T
313 attttatacgctgatgatgt 332  Q
    |||||||||||||| |||||    
19739878 attttatacgctgacgatgt 19739897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0075 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0075
Description:

Target: scaffold0075; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 170 - 240
Target Start/End: Complemental strand, 48800 - 48730
Alignment:
170 gtggtgttcgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct 240  Q
    |||||||||| ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || ||||||    
48800 gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct 48730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 15144264 - 15144206
Alignment:
169 cgtggtgttcgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggt 227  Q
    ||||||||||| ||||| ||||| ||||| || |||||||| |||||||||||||||||    
15144264 cgtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggt 15144206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 170 - 245
Target Start/End: Original strand, 15157214 - 15157289
Alignment:
170 gtggtgttcgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggctctttc 245  Q
    |||||||||| |||||||||||  |||| || |||||||| ||||| ||||||||||| || || |||||| ||||    
15157214 gtggtgttcgacaaggagaccccctgtcccctcttcttttctgtctcgctgaagaggtgctaagccgggctatttc 15157289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 170 - 240
Target Start/End: Complemental strand, 9077 - 9007
Alignment:
170 gtggtgttcgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct 240  Q
    |||||||||| ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || ||||||    
9077 gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct 9007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 170 - 245
Target Start/End: Original strand, 12161203 - 12161278
Alignment:
170 gtggtgttcgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggctctttc 245  Q
    |||||||||| |||||||||||  |||| || |||||||| ||||| ||||||||||| || || |||||| ||||    
12161203 gtggtgttcgacaaggagaccccctgtcccctcttcttttctgtctcgctgaagaggtgctaagccgggctatttc 12161278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0416 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0416
Description:

Target: scaffold0416; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 234
Target Start/End: Original strand, 12499 - 12564
Alignment:
169 cgtggtgttcgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagt 234  Q
    ||||||||||| ||||| ||||| || || || || ||||||||||| || |||||||||||||||    
12499 cgtggtgttcgtcaaggggaccctttatctcctctccttttttgtcttgccgaagaggttcttagt 12564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0114 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0114
Description:

Target: scaffold0114; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 144 - 212
Target Start/End: Complemental strand, 5223 - 5155
Alignment:
144 ggctgttgggttcttttcatgttcgcgtggtgttcgccaaggagacccattgtcaccgcttcttttttg 212  Q
    ||||||||||||||| || ||||| ||||| ||||| ||||| || || ||||| || |||||||||||    
5223 ggctgttgggttcttctcttgttctcgtggggttcgtcaaggcgatcctttgtccccacttcttttttg 5155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 202 - 234
Target Start/End: Complemental strand, 8636245 - 8636213
Alignment:
202 cttcttttttgtctagctgaagaggttcttagt 234  Q
    |||||||||||| ||||||||||||||||||||    
8636245 cttcttttttgtttagctgaagaggttcttagt 8636213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University