View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21328_high_11 (Length: 327)
Name: NF21328_high_11
Description: NF21328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21328_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 3 - 302
Target Start/End: Original strand, 36601772 - 36602052
Alignment:
| Q |
3 |
agcagcaccacagaactatgcttcaaacaagcatacctgacaaacacagcagaaatgcattaacagacaaaccgcaaaagctgccgataaaacgatacca |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
36601772 |
agcagaaccacagaactatgcttcaaacaagcatacctgacaaacacagcagaaatgcattaacagacaaaccgcaaaaactgccgataaaatgatacca |
36601871 |
T |
 |
| Q |
103 |
acccgagccattttgagaccagcctgcacaaatactattccctaaccacaaatctgctcttaattgaaaaaatctgatgaaaaggccactacaacaaaca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36601872 |
acccgagccattttgagaccagcctgcacaaatactattccctaaccacacatctgctcttaattgaaaaaatctgatgaaaaggccactacaacaaaca |
36601971 |
T |
 |
| Q |
203 |
aacgccctgcatctggcagaaaagctcaaaccaccctgaagcaaaaaccagcctcacagaaagttgccaacaaatttgactctccatcttcccctttgat |
302 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36601972 |
aacgccctgcatctggca-------------------gaagcaaaaaccagcctcacagaaagttgccaacaaatttgactctccatcttcccctttgat |
36602052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University