View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21328_high_14 (Length: 317)
Name: NF21328_high_14
Description: NF21328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21328_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 31 - 308
Target Start/End: Original strand, 8956361 - 8956639
Alignment:
| Q |
31 |
taggcaccatcttgtttttgcatagttgcacccattcannnnnnnnnccatgattctttaaatgctgaaaactcaaagtctcaaatgagccagaatgacc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8956361 |
taggcaccatcttgtttttgcatagttgcacccattcatttttttttccatgattctttaaatgctgaaaactcaaagtctcaaatgagccagaatgacc |
8956460 |
T |
|
| Q |
131 |
atacgggaatccacgttgatggtaaaaagtccaaattttgattagaaatatgtcatgggaatcttaactatgttgaatataatagtgcttcagccaccaa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8956461 |
atacgggaatccacgttgatggtaaaaagttcaaattttgattagaaaaatgtcatgggaatcttaactatgttgaatataatagtgcttcagccaccaa |
8956560 |
T |
|
| Q |
231 |
gtttgcttttttcccgtgaccatataaaactataatatgttccg-ttatacactcacttatactactagatagtataat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8956561 |
gtttgcttttttcccgtgaccatataaaactataatatgttccgtttatacactcacttatactactagatagtataat |
8956639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University