View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21329_high_6 (Length: 526)
Name: NF21329_high_6
Description: NF21329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21329_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 468; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 468; E-Value: 0
Query Start/End: Original strand, 1 - 516
Target Start/End: Complemental strand, 3744303 - 3743788
Alignment:
| Q |
1 |
caaaacaaacacactctgtttcttgtcaatcccctgcatgttccgcagcgcatgcatccatgtcttctagtaacctttgtgctatttcacgttgtccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744303 |
caaaacaaacacactctgtttcttgtcaatcccctgcatgttccgcagcgcatgcatccatgtcttctagtaacctttgtgctatttcacgttgtccttt |
3744204 |
T |
 |
| Q |
101 |
agatttcatcgaaacttctgattgttcttctttttcttgtccacctttttactacgcttatggtgatggaagcttcgtcgctaatctctaccaacaaaca |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| || ||||||||| |
|
|
| T |
3744203 |
agattacatcgaaacttctgattgttcttctttttcttgtccacctttttactatgcttatggtgatggaagcttcgtagctaatctgtatcaacaaaca |
3744104 |
T |
 |
| Q |
201 |
ctgtctatctctactcttcatcttcagaatttcacgtttggttgtgctcatactgcactcgctgaacccaccggcgtagctggttttggccgcggaattt |
300 |
Q |
| |
|
|| ||| ||||| ||||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744103 |
ctttctctctcttctcttcatcttcaaaacttcacgtttggttgtgctcatactgcacttgctgaacccaccggcgtagctggttttggccgcggaattt |
3744004 |
T |
 |
| Q |
301 |
tatctcttccggcacagctctctactctctcacctcatttgggtaatcgtttttcttattgtttagtttctcactctttcgacggtgacagactccggcg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744003 |
tatctcttccggcacagctctctactctctcacctcatttgggtaatcgtttttcttattgtttagtttctcactctttcgacggtgacagactccggcg |
3743904 |
T |
 |
| Q |
401 |
accgagtccactcattctcggtcgtcacaatgacaccataacctgcgccggagacggagaatctgttgagtttgtctatacttccatgctttcaaaccca |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3743903 |
accgagtccactcattctcggtcgtcacaatgacaccataaccggcgccggagacggagaatctgttgagtttgtctatacttccatgctttcaaaccca |
3743804 |
T |
 |
| Q |
501 |
aagcatccttattact |
516 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3743803 |
aagcatccttattact |
3743788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University