View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21329_low_12 (Length: 252)
Name: NF21329_low_12
Description: NF21329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21329_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 88 - 240
Target Start/End: Complemental strand, 7246474 - 7246322
Alignment:
| Q |
88 |
tctccttgaacaacaacagcagcagcataaactcaccttcttctttccctttctctacttcatccatggcttgtcatgatcagtcacaatctttttcaca |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7246474 |
tctccttgaacaacaacagcagcagcataaactcaccttcttctttccctttctctacttcatccatggcttgtcatgatcagtcacaatctttttcaca |
7246375 |
T |
 |
| Q |
188 |
atcctatcaaaactcttctttaaacccttactattactctcaatcaattacct |
240 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7246374 |
atcctaccaaaactcttctttaaacccttactattactctcaatcaattacct |
7246322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University