View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2132_low_13 (Length: 253)
Name: NF2132_low_13
Description: NF2132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2132_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 238
Target Start/End: Complemental strand, 12946090 - 12945872
Alignment:
| Q |
20 |
gtaatacaatatttgttctaatattttctaatgggtatcccattgaatattgttaaaatagtgcttcgttgttttgtagtgtttgctttgtgtaggactt |
119 |
Q |
| |
|
|||| ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
12946090 |
gtaaaacattatttgttttaatattttctaatgggtatcccattgaatattgttaaaatagtgcttcgttgtattgtagtgtttgcgttgtgtaggactt |
12945991 |
T |
 |
| Q |
120 |
caacaactacagatgaaaaacctgcaatttttatctttggagattctcttcttgataatggtaacaataattacatttttaccctggctagggctaattt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12945990 |
caacaactacagatgaaaaacctgcaatttttatctttggagattctcttcttgataatggtaacaataattacattgttaccctggctagggctaattt |
12945891 |
T |
 |
| Q |
220 |
tcaaccatatggtattgat |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12945890 |
tcaaccatatggtattgat |
12945872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 193
Target Start/End: Original strand, 48091441 - 48091479
Alignment:
| Q |
155 |
tttggagattctcttcttgataatggtaacaataattac |
193 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
48091441 |
tttggtgattctcttgttgataatggtaacaataattac |
48091479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University