View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2132_low_16 (Length: 239)
Name: NF2132_low_16
Description: NF2132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2132_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 222
Target Start/End: Complemental strand, 36675972 - 36675761
Alignment:
| Q |
11 |
gataattctaattctgtagctactattggtgaaaaagttggtgagattcaatcttgcattgctgacatagaagtgacaatggtggaaaaccatgcaaatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675972 |
gataattctaattctgtagctactattggtgaaaaagttggtgagattcaatcttgcattgctgacatagaagtgacaatggtggaaaaccatgcaaatc |
36675873 |
T |
|
| Q |
111 |
ttaaaataagatcaagaaagaggccaaagcagctcttgaaaattgtatctggtttgcaaaacatgcgtctcacaatcttgcatttaaatgttactactac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675872 |
ttaaaataagatcaagaaagaggccaaagcagctcttgaaaattgtatctggtttgcaaaacatgcgtctcacaatcttgcatttaaatgttactactat |
36675773 |
T |
|
| Q |
211 |
tggtgaaattgt |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36675772 |
tggtgaaattgt |
36675761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 68 - 168
Target Start/End: Original strand, 46922272 - 46922372
Alignment:
| Q |
68 |
attgctgacatagaagtgacaatggtggaaaaccatgcaaatcttaaaataagatcaagaaagaggccaaagcagctcttgaaaattgtatctggtttgc |
167 |
Q |
| |
|
|||||||| || ||||| |||||||| |||| |||||||||||| ||||||||| ||| || || ||||| ||||||||||| || || ||| |||||| |
|
|
| T |
46922272 |
attgctgatattgaagttacaatggttgaaagccatgcaaatctcaaaataagaacaaagaaaagaccaaaacagctcttgaagatggtttctagtttgc |
46922371 |
T |
|
| Q |
168 |
a |
168 |
Q |
| |
|
| |
|
|
| T |
46922372 |
a |
46922372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University