View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2132_low_17 (Length: 215)
Name: NF2132_low_17
Description: NF2132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2132_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 198
Target Start/End: Complemental strand, 37090408 - 37090222
Alignment:
| Q |
15 |
atattgcactttttggccaaggccattatatatannnnnnn---gtttccatatttatattataaatactctctataactaattgattttggcattaaga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37090408 |
atattgcactttttggccaaggccattatatatatatattttttgtttccatatttatattataaatactctctataactaattgattttggcatttaga |
37090309 |
T |
 |
| Q |
112 |
gtccaagatttgtaagattatactctttttgcaatttacacaatttgttattgggtttgacacattgattggtatacatgcataggt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
37090308 |
gtccaagatttgtaagattatactctttttgcaatttacacaatttgttattgggtttgacacattgatgggtatacatgcacaggt |
37090222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University