View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2132_low_7 (Length: 347)
Name: NF2132_low_7
Description: NF2132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2132_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 7 - 338
Target Start/End: Original strand, 43555348 - 43555679
Alignment:
| Q |
7 |
ttttcttcctccaatgttgtcttcttcctcttgcaattgatactctttctgctacatttgggggcagcctccatgtaaacatcattaagagatcgaaatt |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43555348 |
ttttcttcctccaatgttgtcttattcctcttgcaattgatactctttctgctacatttgggggcagcctccatgtaaacatcattaagagatcgaaatt |
43555447 |
T |
|
| Q |
107 |
tcttcatctcataatgatgattctttggctgatgagattcaatcttagttatggcttcatcaaccaactccaatcctttttccaatgtaatcatattcct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43555448 |
tcttcatctcataatgatgattctttggctgatgagattcaatcttagttatggattcatcaaccaactccaatcctttttccaatgtaatcatattcct |
43555547 |
T |
|
| Q |
207 |
cttgctgctactgatcctaacttcattgctcagctgaataagttgctcagcagcttccttttctgtgaactcattttcgtttgtgatttcaagcgattca |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43555548 |
cttgctgctactgatcctaacttcattgctcagctgaataagttgctcagcagcttccttttctgtgaactcattttcgtttgtgatttcaagcgataca |
43555647 |
T |
|
| Q |
307 |
ttagaacgtgcttctgccatttgatgatgatg |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43555648 |
ttagaacgtgcttctgccatttgatgatgatg |
43555679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University