View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21330_high_12 (Length: 317)

Name: NF21330_high_12
Description: NF21330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21330_high_12
NF21330_high_12
[»] chr6 (1 HSPs)
chr6 (229-312)||(7869702-7869785)


Alignment Details
Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 229 - 312
Target Start/End: Complemental strand, 7869785 - 7869702
Alignment:
229 cacttacacttttatgtggtttaaaaaattaatgttttttagccagtatgaatattaatttgggtggcagaagaatagaattta 312  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
7869785 cacttacacttttatgtggtttaaaaaattaatgttttttagccagtatgcatattaatttgggtggcagaagaatagaattta 7869702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University