View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21330_high_12 (Length: 317)
Name: NF21330_high_12
Description: NF21330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21330_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 229 - 312
Target Start/End: Complemental strand, 7869785 - 7869702
Alignment:
| Q |
229 |
cacttacacttttatgtggtttaaaaaattaatgttttttagccagtatgaatattaatttgggtggcagaagaatagaattta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7869785 |
cacttacacttttatgtggtttaaaaaattaatgttttttagccagtatgcatattaatttgggtggcagaagaatagaattta |
7869702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University