View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21331_high_2 (Length: 209)

Name: NF21331_high_2
Description: NF21331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21331_high_2
NF21331_high_2
[»] chr8 (1 HSPs)
chr8 (11-189)||(41129604-41129783)


Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 11 - 189
Target Start/End: Original strand, 41129604 - 41129783
Alignment:
11 gagaagcaaaggactgagacctctaacgaattggttttgtttgaatacggatggaacatccaaa-ggtagcaacaggcttgctagctggggtgagaactt 109  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||    
41129604 gagaaccaaaggactgagacctctaacgaattggttttgtttgaatacggatggaacatccaaaaggtagcaacgggcttgctagctggggtgagaactt 41129703  T
110 atcaaggatgataatggtgcttaaaatatgcgattttactaaaaaattggggcaaactaacacatttatggcataaatat 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
41129704 atcaaggatgataatggtgcttaaaatatgcgattttactaaaaatttggggcaaactaacacatttatggcataaatat 41129783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University