View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21331_low_2 (Length: 209)
Name: NF21331_low_2
Description: NF21331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21331_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 11 - 189
Target Start/End: Original strand, 41129604 - 41129783
Alignment:
| Q |
11 |
gagaagcaaaggactgagacctctaacgaattggttttgtttgaatacggatggaacatccaaa-ggtagcaacaggcttgctagctggggtgagaactt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41129604 |
gagaaccaaaggactgagacctctaacgaattggttttgtttgaatacggatggaacatccaaaaggtagcaacgggcttgctagctggggtgagaactt |
41129703 |
T |
 |
| Q |
110 |
atcaaggatgataatggtgcttaaaatatgcgattttactaaaaaattggggcaaactaacacatttatggcataaatat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41129704 |
atcaaggatgataatggtgcttaaaatatgcgattttactaaaaatttggggcaaactaacacatttatggcataaatat |
41129783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University