View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21333_low_7 (Length: 346)
Name: NF21333_low_7
Description: NF21333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21333_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 9500588 - 9500426
Alignment:
| Q |
1 |
cccaagcagagagcaataatcatagttgtcaatcccaaatagaaatgaggagccttctatcccaaaagcataccagataccaggatgacttcaataccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500588 |
cccaagcagagagcaataatcatagttgtcaatcccaaatagaaatgaggagccttctatcccaaaagcataccagataccaggatgacttcaataccaa |
9500489 |
T |
|
| Q |
101 |
taaccggcttttacttataaactacaagtaatttatatttatattacgttacacacataaatgtt |
165 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9500488 |
taaccggattttacttataa--tacaagtaatttatatttatattacgttatacacataaatgtt |
9500426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 194 - 329
Target Start/End: Complemental strand, 9500397 - 9500263
Alignment:
| Q |
194 |
ttcaggcatagttgataaatcaataggatagggcttaaaattgttacatacacaaatcataaaatatatttttgataattgatatgtcaactgaagctta |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9500397 |
ttcaggcatagttgataaatcaataggatagggcttaaaattgttacatacacaaatcataaaatata-ttttgataattgatatgtcaactgaagctta |
9500299 |
T |
|
| Q |
294 |
tgcagacaactcgagtaacttataatacatgcatat |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500298 |
tgcagacaactcgagtaacttataatacatgcatat |
9500263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University