View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21334_low_7 (Length: 234)
Name: NF21334_low_7
Description: NF21334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21334_low_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 234
Target Start/End: Complemental strand, 37590425 - 37590201
Alignment:
| Q |
7 |
gagatgaacgcggccgaggatagagagggaagagcagttggagcggtagaaagtgaggaggtcattgaggtttggaatatcgacgtacttgtagtagagg |
106 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37590425 |
gagacgaacgcggccgaggagagagagggaagagcagttggagcggtagaaagtgaggaggtcattgaggtttggaatatcgacgtacttgtagtagagg |
37590326 |
T |
|
| Q |
107 |
agaacgccgtattgttggtcggtggttttgtcgtcggacatggtttccggtggattttggagttcagggtttatggatcgctcagttctacggctaagga |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37590325 |
agaacgccgtattg---gtcggtggttttgtcgtcggacatggtttccggtggattttggagttcagggtttatggatcgctcagttctacggctaagga |
37590229 |
T |
|
| Q |
207 |
gggagaggcggtgtcgtcgtgtataatt |
234 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
37590228 |
gggtgaggcggtgtcgtcgtgtataatt |
37590201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University