View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21334_low_7 (Length: 234)

Name: NF21334_low_7
Description: NF21334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21334_low_7
NF21334_low_7
[»] chr1 (1 HSPs)
chr1 (7-234)||(37590201-37590425)


Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 234
Target Start/End: Complemental strand, 37590425 - 37590201
Alignment:
7 gagatgaacgcggccgaggatagagagggaagagcagttggagcggtagaaagtgaggaggtcattgaggtttggaatatcgacgtacttgtagtagagg 106  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37590425 gagacgaacgcggccgaggagagagagggaagagcagttggagcggtagaaagtgaggaggtcattgaggtttggaatatcgacgtacttgtagtagagg 37590326  T
107 agaacgccgtattgttggtcggtggttttgtcgtcggacatggtttccggtggattttggagttcagggtttatggatcgctcagttctacggctaagga 206  Q
    ||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37590325 agaacgccgtattg---gtcggtggttttgtcgtcggacatggtttccggtggattttggagttcagggtttatggatcgctcagttctacggctaagga 37590229  T
207 gggagaggcggtgtcgtcgtgtataatt 234  Q
    ||| ||||||||||||||||||||||||    
37590228 gggtgaggcggtgtcgtcgtgtataatt 37590201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University