View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21334_low_8 (Length: 202)
Name: NF21334_low_8
Description: NF21334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21334_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 4 - 177
Target Start/End: Original strand, 4134122 - 4134295
Alignment:
| Q |
4 |
aaaacctatggtgatctctaactcttttattgtgatttaatctgctctagtattgnnnnnnnatggtaaacaaatcttgctcgtaattatattcaatact |
103 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4134122 |
aaaacctacggtgatctctaactctttcattgtgatttaatctgctctagtattgtttttttatggtaaacaaatcttgctcataattatattcaatact |
4134221 |
T |
 |
| Q |
104 |
aggaaagagaggtcaatggaaacagatctctttctttatttcaatcacacaaaccatataccatgacaatcgag |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
4134222 |
gggaaagagaggtcaatggaaacagatctctttctttatttcaatcacacaaatcctatatcatgacaatcgag |
4134295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 4 - 177
Target Start/End: Original strand, 22212287 - 22212459
Alignment:
| Q |
4 |
aaaacctatggtgatctctaactcttttattgtgatttaatctgctctagtattgnnnnnnnatggtaaacaaatcttgctcgtaattatattcaatact |
103 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
22212287 |
aaaacctattgtgatctctaactcttttattgtgatttaatctgctctagtattgtttttt-atggtaaacagatcttgctcataattatattcaatact |
22212385 |
T |
 |
| Q |
104 |
aggaaagagaggtcaatggaaacagatctctttctttatttcaatcacacaaaccatataccatgacaatcgag |
177 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22212386 |
gagaaagagaggtcaatggaaacatatctctttctttatttcaatcacacaaaccatatatcatgacaatcgag |
22212459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 105 - 148
Target Start/End: Original strand, 44886085 - 44886128
Alignment:
| Q |
105 |
ggaaagagaggtcaatggaaacagatctctttctttatttcaat |
148 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
44886085 |
ggaaagagaggtcaatggaaaatgatctctttctttgtttcaat |
44886128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University