View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21335_low_6 (Length: 264)
Name: NF21335_low_6
Description: NF21335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21335_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 40326828 - 40326577
Alignment:
| Q |
1 |
aacagatgatgattttttgtctctagtgaagaagcaatggcaaaacaaaccacagatagcatctgctggtacatgttgtttggcggggataatttgcaac |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40326828 |
aacagatgatgattttctgtctctagtgaagaagcaatggcaaaacaaaccacagatagcatctgctggtacatgttgtttggcggggataatttgcaac |
40326729 |
T |
|
| Q |
101 |
ggtaagctgtatattgcaaatgcaggagactcaagggctgtgttaggaagagtgaggaggggaacaagggaaacattagctgttcagttatctacagaac |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40326728 |
ggtatgctgtatattgcaaatgcaggagactcaagggctgtgttaggaagagtgaggaggggaacaagggaaacattagccgttcagttatctacagaac |
40326629 |
T |
|
| Q |
201 |
acaatgttaatatagaaactgagagagatgatgttcggtcaaagcaccccta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40326628 |
acaatgttaatatagaaactgagagagatgatgttcggtcaaagcaccccta |
40326577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 50 - 210
Target Start/End: Complemental strand, 28939013 - 28938853
Alignment:
| Q |
50 |
ccacagatagcatctgctggtacatgttgtttggcggggataatttgcaacggtaagctgtatattgcaaatgcaggagactcaagggctgtgttaggaa |
149 |
Q |
| |
|
||||| || ||||| || ||||| |||||||||| ||||||||||||||| || | | |||||||||||| | || |||||||||| |||||||||| |
|
|
| T |
28939013 |
ccacatattgcatcagcaggtacttgttgtttggtggggataatttgcaatggactggtatatattgcaaattctggtgactcaagggtggtgttaggaa |
28938914 |
T |
|
| Q |
150 |
gagtgaggaggggaacaagggaaacattagctgttcagttatctacagaacacaatgttaa |
210 |
Q |
| |
|
|| | ||||| |||||||||||||| ||| | || |||||| ||||||| |||||||| |
|
|
| T |
28938913 |
gactagagagggcaacaagggaaacatcagccatacaattatctgcagaacataatgttaa |
28938853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University