View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21336_low_1 (Length: 346)
Name: NF21336_low_1
Description: NF21336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21336_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 58 - 233
Target Start/End: Original strand, 22361411 - 22361583
Alignment:
| Q |
58 |
aaaacaacgacaccagtattaatggcagtaaacaaatttagtaagtcagtcaagacataccttaacctacaaaaatggcttagagtgaaaactgacttgc |
157 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22361411 |
aaaacaacgacatcagtattaatggcagtaaacaaatttagcaagtcaatcaagacatacctgaacctacaaaaatggcttacagtgaaaactgacttgc |
22361510 |
T |
|
| Q |
158 |
caggtgaattaggccatcacattgtgagattctcaacagaattccataaacaaggaaattacattttgttcacaac |
233 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
22361511 |
aaggtgaattagg---tcacattgtgggattctcaacagaattccatgaacaagaaaattacattttgttcacaac |
22361583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 297 - 336
Target Start/End: Original strand, 22361697 - 22361736
Alignment:
| Q |
297 |
tccataatcacatcattaacaaaccctttaacaccctttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22361697 |
tccataatcacatcattaacaaaccctttaacaccctttg |
22361736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University