View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21337_low_2 (Length: 250)
Name: NF21337_low_2
Description: NF21337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21337_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 31112043 - 31111827
Alignment:
| Q |
18 |
gatgaaggagtgtgactgcttacgcctccgtctgaatcgtgcaaaggagatcctccgcaacgaggagaagaaggaactttgtgccatggatcctgatttt |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31112043 |
gatgaaggagtgtgaccgcttacgcctccgtctgaatcgtgcaaaggagatcctccgcaacgaggagaaaaaggaactttgtgccatggatcctgatttt |
31111944 |
T |
 |
| Q |
118 |
catctttctcagaagcaacattttctaccacattcattggagtggcggtttgttgatttcgttgaacgaccttaatttaagtcacatttgcagcagaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31111943 |
catctttctcagaagcaacattttctaccacattcattggagtggcggtttgttgatttcgttgaacgaccttaatttaagtcacatttgcagcagaaat |
31111844 |
T |
 |
| Q |
218 |
tttatattgattttctt |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31111843 |
tttatattgattttctt |
31111827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University