View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21337_low_3 (Length: 222)
Name: NF21337_low_3
Description: NF21337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21337_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 159
Target Start/End: Complemental strand, 23504094 - 23503954
Alignment:
| Q |
19 |
atgaggctgacactaatgattaagtttgatgtttcaatcataaataagccaaactgccacaagaaaaattcctaattgtccttcctaacaccaggtgtgc |
118 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23504094 |
atgagactgacactattgattaagtttgatgtttcaatcataaataagccaaactgccacaagaaaaattcctaattgtccttcctaacaccaggtgtgc |
23503995 |
T |
 |
| Q |
119 |
caaggaagaacataagagtcaataaaatatttacaggacag |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23503994 |
caaggaagaacataagagtcaataaaatatttacaggacag |
23503954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 95 - 153
Target Start/End: Complemental strand, 9485068 - 9485010
Alignment:
| Q |
95 |
tgtccttcctaacaccaggtgtgccaaggaagaacataagagtcaataaaatatttaca |
153 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||| | ||||| |||| |
|
|
| T |
9485068 |
tgtccttcctagcacaaggtgtgccaaggaagaacataagagtcaaaacaatatgtaca |
9485010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University