View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21338_high_18 (Length: 224)
Name: NF21338_high_18
Description: NF21338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21338_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 208
Target Start/End: Original strand, 37054341 - 37054533
Alignment:
| Q |
12 |
agaatatctgttaaagtacaagttcacaaatgatttagtaacaatttaagttacatgttactactttttaatgaatataggcaatatatatcttaatata |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37054341 |
agaatatctgttaaagtacaagttcacaaatgatttagtaacaatttaagttacatgttactactttttaatgaatataggcaatat----cttaatata |
37054436 |
T |
 |
| Q |
112 |
ttatgatgaattcaatttgaaggtaccttccatccctttggaatggtaaagccttcataggtgaaatctgttttagcctctctgaatgctcctggtg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054437 |
ttatgatgaattcaatttgaaggtaccttccatccctttggaatggtaaagccttcataggtgaaatctgttttagcctctctgaatgctcctggtg |
37054533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University