View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21339_high_11 (Length: 348)
Name: NF21339_high_11
Description: NF21339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21339_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 16 - 316
Target Start/End: Original strand, 43614086 - 43614387
Alignment:
| Q |
16 |
caattacaatgataatattgtttatgtggaataaaccatatttttctcaataatgtcgtaattaaacatataataataatggattcaatttctataacat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43614086 |
caattacaatgataatattgtttatgtggaataaaccatatttttctcaataatgtcgtaattaaacatataataataatggattcaatttctataacat |
43614185 |
T |
 |
| Q |
116 |
ctcaattctcaaactgcactctcttctttcatttcatcaatcacttaagtcaatcccacaaacac-aaagatgactggcccagttaatggcgaacccacc |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||| || ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43614186 |
ctcaattctcaaactgcactctcttatttcatttcatcaatcactcaagtgaaccccacaaacacaaaagatgactggcccagttaatggcgaacccacc |
43614285 |
T |
 |
| Q |
215 |
atcaagttcaccaagttattcatcgatggagattttgtggattcggttacaggtcaatactataataatatatttccatttattttgttcacactagtgc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43614286 |
atcaagttcaccaagttattcatcgatggagattttgtggattcggttacaggtcaatactataataatatatttccatttattttgttcacactagtgc |
43614385 |
T |
 |
| Q |
315 |
ta |
316 |
Q |
| |
|
|| |
|
|
| T |
43614386 |
ta |
43614387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University