View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21339_high_23 (Length: 250)
Name: NF21339_high_23
Description: NF21339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21339_high_23 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 33902061 - 33901824
Alignment:
| Q |
9 |
gaagaatattaacagtagaagaagccttgcctctgctgcagcaacaagttcatagaaatctttaactggcatattcttgaagagttttgcagttacaacc |
108 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33902061 |
gaagaatattaaaagtagaagaagccttgcctctgctgcagcaacaagttcatagaaatctttaactggcatattcttgaagagttttgtagttacaacc |
33901962 |
T |
|
| Q |
109 |
actggctttccaatagtgagagttcctgtcttatcgaacacaatgcaattcacctgaaaaattgtaagtaacaagttatatagtttcctactcttgaaat |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
33901961 |
actggcttcccaatagtgagagttcctgtcttatcgaacacaatgcaattcacctgaaaaattgtaagtaacaagt----tagtttcctactgttgaaat |
33901866 |
T |
|
| Q |
209 |
ggcaagttgagagaacaatggatgcatgcaattgccaatgtt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33901865 |
ggcaagttgagagaacaatggatgcatgcaattgccaatgtt |
33901824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University