View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21339_high_5 (Length: 434)
Name: NF21339_high_5
Description: NF21339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21339_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 10 - 236
Target Start/End: Complemental strand, 41953610 - 41953386
Alignment:
| Q |
10 |
agatgaaagcgatgaagattctgacaaggagacaccgaagaaggtaactggagactatattgtgcttcgatttgtctccgaatttgaatttaa-tatgag |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||| |
|
|
| T |
41953610 |
agatgaaagcgatgaagattctgatgaggagacaccgaagaaggtaactggagactatattgtgcttcgatttgtctctgaatttgaatttaattttgag |
41953511 |
T |
 |
| Q |
109 |
ttttgttttagactgaagggagcaacaagaggagggatgctgaatcttccaaggaaacacatgtacttgtgaaaaaggcaaaatttgttactccagagaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||| |||||| |||||||||||||| ||||||||||| |
|
|
| T |
41953510 |
ttttgttttagactgaagggagcaacaa---gagggttgctgaatcttccaaggaaacacctgtacctgtgaagaaggcaaaatttgtcactccagagaa |
41953414 |
T |
 |
| Q |
209 |
gactggttagttctttcccctgtacttt |
236 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
41953413 |
gactggttagttttttcccctgtacttt |
41953386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 348 - 417
Target Start/End: Complemental strand, 41952822 - 41952753
Alignment:
| Q |
348 |
ccttaccctaagcaggctggtaaatctgctgcaaataacaagcagccagagaagcaggagactccaaagt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41952822 |
ccttaccctaagcaggctggtaaatctgctgcaaataacaagcagccagagaagcaggagactccaaagt |
41952753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University