View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2133_high_24 (Length: 238)
Name: NF2133_high_24
Description: NF2133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2133_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 33640434 - 33640583
Alignment:
| Q |
1 |
atttaagcatttttatttatttatcaaactactaattaatacttatgagtgtctttaatttgatggatgaattggtggtgaggactaattaagatagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33640434 |
atttaagcatttttatttatttatcaagctagtaattaatacttatgagtgtctttaatttgatggatgaattggtggtgaggac----taagatagata |
33640529 |
T |
|
| Q |
101 |
atgatgagtgagagaatagtgaagaggttagtttgtgaaaggaaatgctcttgt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
33640530 |
atgatgagtgagagaatagtgaagaggtcagtttgtgaaaggaaatgcccttgt |
33640583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 33640825 - 33640874
Alignment:
| Q |
171 |
acatgaatgatgattgatggtatggtaccataccttcaaaatggtccaac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33640825 |
acatgaatgatgattgatggtatggtaccataccttcaaaatggtccaac |
33640874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University