View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2133_high_25 (Length: 231)
Name: NF2133_high_25
Description: NF2133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2133_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 26 - 215
Target Start/End: Original strand, 1501965 - 1502154
Alignment:
| Q |
26 |
taattattatggtcgagacatcaaaatctctatagttcatgatttgatatatgatattatttttcttggtaaaaatatatttaaccctatcttttaaaaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1501965 |
taattattatggtcgagacatcaaaatctctatagttcatgatttgatatatgatattatttttcttggtaaaaatatatttaaccctatcttttaaaaa |
1502064 |
T |
|
| Q |
126 |
attagttacactgtcggtgtatgtttattttactctatttagaaaatgtggagaaggccataataaagacatcctttggatccaataaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1502065 |
attagttacactgtcggtgtatgtttattttactctatttagaaaatgtggagaaggctataataaagacatcctttggatccaataaag |
1502154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University