View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2133_high_29 (Length: 205)
Name: NF2133_high_29
Description: NF2133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2133_high_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 68 - 196
Target Start/End: Original strand, 30024792 - 30024920
Alignment:
| Q |
68 |
cttaaagattctcgaataactagtgggcttacaagcctgtgggcttccataactacccgtgcaacaatacttaggtgagttaaaagcataacaagcactc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30024792 |
cttaaagattctcgaataactagtgggcttacaagcctgtgggcttccataactacccgtgcaacaatactcaggtgagttaaaagcataacaagcactc |
30024891 |
T |
|
| Q |
168 |
ttacaacccaccacttgattcatatcact |
196 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |
|
|
| T |
30024892 |
ttacagcccaccacttgattcatgtcact |
30024920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 18481571 - 18481643
Alignment:
| Q |
5 |
cattattgaataatacaagggtaacttcgacgaaggataagaaaacgtggcactgaatttgaccttaaagatt |
77 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |||||||||| |
|
|
| T |
18481571 |
cattattcaataatacaagggtaatttcgacgaaggataagaaaacttggcagtgaatttgaacttaaagatt |
18481643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University