View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2133_low_12 (Length: 424)
Name: NF2133_low_12
Description: NF2133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2133_low_12 |
 | |
|
| [»] scaffold0341 (2 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 297 - 410
Target Start/End: Complemental strand, 37205561 - 37205448
Alignment:
| Q |
297 |
aaaagggttagttgtttctggatttgatgctattgttgttaatgcttcaacttcaacttttgtttccatcaatgttgaggttttgaattccattcttcat |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37205561 |
aaaagggttagttgtttctggatttgatgctattgttgttaatgcttcaacttcaacttttgtttccatcaatgttgaggttttgaattccattcttcat |
37205462 |
T |
|
| Q |
397 |
gatttgggtgatga |
410 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37205461 |
gatttgggtgatga |
37205448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 131 - 221
Target Start/End: Complemental strand, 37205727 - 37205637
Alignment:
| Q |
131 |
agattaacgtaatgggtaagcaacattttcaaggtggtagggttggtttaacttctgatgctttcttggtgattaaggttcctgatacacg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37205727 |
agattaacgtaatgggtaagcaacatttgcaaggtggtagggttggtttaacttctgatgctttcttggtgattaaggttcctgatacacg |
37205637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 37205840 - 37205797
Alignment:
| Q |
18 |
gaaaccacaccgctgcaaggttctgcactcgctaaagttctcac |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37205840 |
gaaaccacaccgctgcaaggttctgcactcgctaaagttctcac |
37205797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0341 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: scaffold0341
Description:
Target: scaffold0341; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 364 - 405
Target Start/End: Complemental strand, 3835 - 3794
Alignment:
| Q |
364 |
atcaatgttgaggttttgaattccattcttcatgatttgggt |
405 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
3835 |
atcaatgttaaggttttgaattccattgttcatgatttgggt |
3794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0341; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 364 - 405
Target Start/End: Complemental strand, 11491 - 11450
Alignment:
| Q |
364 |
atcaatgttgaggttttgaattccattcttcatgatttgggt |
405 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
11491 |
atcaatgttaaggttttgaattccattgttcatgatttgggt |
11450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 364 - 405
Target Start/End: Complemental strand, 6509811 - 6509770
Alignment:
| Q |
364 |
atcaatgttgaggttttgaattccattcttcatgatttgggt |
405 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
6509811 |
atcaatgttaaggttttgaattccattgttcatgatttgggt |
6509770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University