View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2133_low_24 (Length: 273)
Name: NF2133_low_24
Description: NF2133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2133_low_24 |
 | |
|
| [»] scaffold0078 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 4649321 - 4649569
Alignment:
| Q |
1 |
agaattcaaaacaagtgataaacagggttctaaatcatataatattggctttgataccacatatgtgagaagatattgaatattatatgagatagaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4649321 |
agaattcaaaacaagtgataaacagggttctaaatcatataatattggctttgataccacat--gtgagaagatattgaatattatacgagatagaacat |
4649418 |
T |
|
| Q |
101 |
acttacttgttggtagcattgtcatggatgagtcttcctttgcctttcacggtgctccagttcttgatgtggtaaaccactaatgagcataaacatcaga |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
4649419 |
acttacttgttggtagcaatgtcatggatgagtcttcctttgcctttcacggtgctccagttctcgatgtggtaaaccactgatgagcagaaacatcaga |
4649518 |
T |
|
| Q |
201 |
gtgatggaaaatggaacctagcctttctatttattattgtacaatcctagt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4649519 |
gtgatggaaaatggaacctagcctttctatttattattgtgcaatcctagt |
4649569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 63 - 150
Target Start/End: Original strand, 24040077 - 24040163
Alignment:
| Q |
63 |
atgtgagaagatattgaatattatatgagatagaacatacttacttgttggtagcattgtcatggatgagtcttcctttgcctttcac |
150 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||| | ||| |||||| || |||||||| ||| |||||||||||||||||| |
|
|
| T |
24040077 |
atgtgagaaaatattcaatattatatgagatagaacaca-ttagttgttgatactgatgtcatggctgaatcttcctttgcctttcac |
24040163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 234
Target Start/End: Complemental strand, 13871 - 13811
Alignment:
| Q |
174 |
aaaccactaatgagcataaacatcagagtgatggaaaatggaacctagcctttctatttat |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||| || ||||||||| ||||||||| |
|
|
| T |
13871 |
aaaccactaatgagcataatagtcagagtgatggcaaaggggacctagcctctctatttat |
13811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 30238412 - 30238456
Alignment:
| Q |
106 |
cttgttggtagcattgtcatggatgagtcttcctttgcctttcac |
150 |
Q |
| |
|
|||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
30238412 |
cttgttggtaccaatgtcatggttgagtcttcctttgcctttcac |
30238456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 3577586 - 3577542
Alignment:
| Q |
106 |
cttgttggtagcattgtcatggatgagtcttcctttgcctttcac |
150 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
3577586 |
cttgttggtaccgatgtcatggctgagtcttcctttgcctttcac |
3577542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 174 - 234
Target Start/End: Complemental strand, 25473864 - 25473804
Alignment:
| Q |
174 |
aaaccactaatgagcataaacatcagagtgatggaaaatggaacctagcctttctatttat |
234 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||| || ||||| ||||||||||||| |
|
|
| T |
25473864 |
aaaccactaatgagcagaatagttagagtgatggaaaaggggacctaacctttctatttat |
25473804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University