View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2133_low_28 (Length: 249)
Name: NF2133_low_28
Description: NF2133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2133_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 33640439 - 33640280
Alignment:
| Q |
1 |
ttaaatatgtttttggtcattgtaaattttgtcggtttgggttttggtcccggtaaaattattatgacatatacctatgcaaaattcaaaaat-ttctnn |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
33640439 |
ttaaatatgtttttggtcattgtaaattttgtcggtttgggttttgatcccggtaaaattattatgacatatacctatacaaaattcaaaaaaattctaa |
33640340 |
T |
|
| Q |
100 |
nnnnngttgctaaaactatctttgttgatataaggtttttggtggagcatgacaaagttc |
159 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33640339 |
aaaaagttgctaaaattatgtttgttgatataatgtttttggtggagcatgacaaagttc |
33640280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University