View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2133_low_30 (Length: 246)
Name: NF2133_low_30
Description: NF2133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2133_low_30 |
 | |
|
| [»] scaffold0693 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0693 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 3641 - 3442
Alignment:
| Q |
18 |
aaaagacaggcttcaaatgctgaagtgtttgtggcgaatgtcaagtacacaacaatctgttattaaaaaccaagatttgtcaaatgattatttcaatcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3641 |
aaaagacaggcttcaaatgctgaagtgtttgtggcgaatgtcaagtacacaacaatctgttattaaaaaccaagatttgtcaaatgattatttcaatcaa |
3542 |
T |
|
| Q |
118 |
tgatttaattcatatgcaccgttaggtatcaattttaatcaaaagatcattacaaatattgactttaatcctaactactttaatcaaaagatcattacaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3541 |
tgatttaattcatatgcaccgttaggtatcaattttaatcaaaagatcattacaaatattgactttaatcctaactactttaatcaaaagatcattacaa |
3442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University