View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21342_low_22 (Length: 242)
Name: NF21342_low_22
Description: NF21342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21342_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 17 - 136
Target Start/End: Original strand, 45107748 - 45107867
Alignment:
| Q |
17 |
actctttgttaaaaacatttctatgttttggatcccagatagagaaacataaaccaatgagcataggggttactaaccccaaaagtgaaatcgtccatcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45107748 |
actctttgttaaaaacatttctatgttttggatcccagatagagaaacataaaccaatgagcataggggttactaaccccaaaagcgaaatcgtccatcc |
45107847 |
T |
 |
| Q |
117 |
ttttcttcctgtccttctga |
136 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45107848 |
ttttcttcctgtccttctga |
45107867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 130 - 242
Target Start/End: Complemental strand, 45108552 - 45108440
Alignment:
| Q |
130 |
cttctgaactataatgtttgcatttccaccccgcctaatattctctcccatggcatatggggaaaacatgagaccgaagggagtccattcaggtgctctt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
45108552 |
cttctaaactataatgtttgcatttccaccccgcctaatattctctcccatggcatatggggaaaacatgagtccgaagggagtccattcaggtcctctt |
45108453 |
T |
 |
| Q |
230 |
tcccagtatttct |
242 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45108452 |
tcccagtatttct |
45108440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University