View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21343_high_8 (Length: 272)
Name: NF21343_high_8
Description: NF21343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21343_high_8 |
 |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0032 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 38940 - 39193
Alignment:
| Q |
1 |
atcatctcctccaatagcttcaccggtattccatgattcaccacctggaaaaacccagctgttccagctgcctgtcggattaccgcaacaatatcggagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940 |
atcatctcctccaatagcttcaccggtattccatgattcaccacctggaaaaacccagctgttccagctgcctgtcggattaccgcaacaatatcggagc |
39039 |
T |
 |
| Q |
101 |
gtttttcgacgatgtcattaaggtctatcacaggaatgttgaactgtgtcgaggtcagtttgccggaaattggggtggtgttggtgttggtgttgccgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39040 |
gtttttcgacgatgtcattaaggtctatcacaggaatgttgaactgtgtcgaggtcagtttgccggaaattggggtggtgttggtgttggtgttgccgat |
39139 |
T |
 |
| Q |
201 |
ttcttccggcatcacgaatatttttggtattttcgtgatgccggagtcaataag |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39140 |
ttcttccggcatcacgaatatttttggtattttcgtgatgccggagtcaataag |
39193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 3 - 56
Target Start/End: Original strand, 10715463 - 10715516
Alignment:
| Q |
3 |
catctcctccaatagcttcaccggtattccatgattcaccacctggaaaaaccc |
56 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||||||||||| || |||||||| |
|
|
| T |
10715463 |
catctcctccaacagtttcactggtattccatgattcaccacttgaaaaaaccc |
10715516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University