View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21343_low_8 (Length: 272)

Name: NF21343_low_8
Description: NF21343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21343_low_8
NF21343_low_8
[»] scaffold0032 (1 HSPs)
scaffold0032 (1-254)||(38940-39193)
[»] chr7 (1 HSPs)
chr7 (3-56)||(10715463-10715516)


Alignment Details
Target: scaffold0032 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: scaffold0032
Description:

Target: scaffold0032; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 38940 - 39193
Alignment:
1 atcatctcctccaatagcttcaccggtattccatgattcaccacctggaaaaacccagctgttccagctgcctgtcggattaccgcaacaatatcggagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38940 atcatctcctccaatagcttcaccggtattccatgattcaccacctggaaaaacccagctgttccagctgcctgtcggattaccgcaacaatatcggagc 39039  T
101 gtttttcgacgatgtcattaaggtctatcacaggaatgttgaactgtgtcgaggtcagtttgccggaaattggggtggtgttggtgttggtgttgccgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39040 gtttttcgacgatgtcattaaggtctatcacaggaatgttgaactgtgtcgaggtcagtttgccggaaattggggtggtgttggtgttggtgttgccgat 39139  T
201 ttcttccggcatcacgaatatttttggtattttcgtgatgccggagtcaataag 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39140 ttcttccggcatcacgaatatttttggtattttcgtgatgccggagtcaataag 39193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 3 - 56
Target Start/End: Original strand, 10715463 - 10715516
Alignment:
3 catctcctccaatagcttcaccggtattccatgattcaccacctggaaaaaccc 56  Q
    |||||||||||| || ||||| |||||||||||||||||||| || ||||||||    
10715463 catctcctccaacagtttcactggtattccatgattcaccacttgaaaaaaccc 10715516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University