View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21343_low_9 (Length: 228)
Name: NF21343_low_9
Description: NF21343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21343_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 54218278 - 54218482
Alignment:
| Q |
1 |
attgaagttatctaagagaatcttggggccaaaccaagatacatgatgcaagaaggggcgttatacatgtaaaaccattgatgattcaattttgattaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54218278 |
attgaagttatctaagagaatcttggggccaaaccaagatacatgatgcgagaaggggcgttatacatgtaaaaccattgatgattcaattttgattaaa |
54218377 |
T |
|
| Q |
101 |
ggactttcattcctctacaaatggaatcaagcagaatgtgcaaaccatctttaataacattagttggttgcttggtaatgaagatacgatcaagtttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54218378 |
ggactttcattcctctacaaatggaatcaagcagaatgtgcaaaccatctttaataacattagttggttgcttggtaatgaagatacgatcaagtttttg |
54218477 |
T |
|
| Q |
201 |
atctg |
205 |
Q |
| |
|
||||| |
|
|
| T |
54218478 |
atctg |
54218482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University