View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21344_low_4 (Length: 348)
Name: NF21344_low_4
Description: NF21344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21344_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 18 - 322
Target Start/End: Original strand, 3706225 - 3706529
Alignment:
| Q |
18 |
agcatctcacctcgtagtttgtcaggaatggtgtcaacaagaacaagctcgtcgactaggtcttgtgttaggatggtttgagctatagccattcccacgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3706225 |
agcatctcacctcgtagtttgtcaggaatggcgtcaacaagaacaagctcgtcgactaggtcttgtgttaggatggtttgagctatagccattcccacgt |
3706324 |
T |
|
| Q |
118 |
tgcctgcgccgataactgagatcttgttgtggcgtttggttggagaaggaggtgaggcatgttggatggacttgaagaaggattgagttaggtccaaacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3706325 |
tgcctgcgccgataactgagatcttgttgtggcgtttggttggagaaggaggtgaggcatgttggatggacttgaagaaggattgagttaggtccaaacc |
3706424 |
T |
|
| Q |
218 |
acctggtcccaatgatgaacctgatatgcttttgtgcatttggatttgcttgtgctgatttgagtaaaggtaaatgcgaagtgtgtgatgggaaaatttg |
317 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3706425 |
atctggtcccaatgatgaacctgatatgcttttgtgcattttgatttgcttgtgctgatttgagtaaaggtaaatgtgaagtgtgtgatgggaaaatttg |
3706524 |
T |
|
| Q |
318 |
atttg |
322 |
Q |
| |
|
||||| |
|
|
| T |
3706525 |
atttg |
3706529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 75 - 148
Target Start/End: Complemental strand, 41765220 - 41765147
Alignment:
| Q |
75 |
aggtcttgtgttaggatggtttgagctatagccattcccacgttgcctgcgccgataactgagatcttgttgtg |
148 |
Q |
| |
|
|||||||| ||||||||||| ||||| || ||||| || |||||||| |||||||| || |||||||||||||| |
|
|
| T |
41765220 |
aggtcttgagttaggatggtctgagcaatggccatgccgacgttgccggcgccgatgacggagatcttgttgtg |
41765147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University