View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21345_high_5 (Length: 262)
Name: NF21345_high_5
Description: NF21345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21345_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 23467553 - 23467325
Alignment:
| Q |
12 |
aagaatattacaaaggtgagaaatctaataatttatcttttatcttccattccatctttatcatacaacataaaatgtgaagttctgatatggaagataa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23467553 |
aagaatattacaaaggtgagaaatctaataattcaacttttatcttccattccatctttatcataaaacataaaatgtgaagttctgatatggaagataa |
23467454 |
T |
|
| Q |
112 |
gagagtgaatatactcgctgctatatcagtgataacactgattatcatcataatcattgctcgtatcttgttaaagctgtcaaaggctttcttcctcatc |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23467453 |
gagagtgaatataatcgctgctatatcagtggtaacactgattatcatcataatcattgcacgtattttgttaaagctgtcaaaggctttcttcctcatc |
23467354 |
T |
|
| Q |
212 |
tgtggcgctggcgttgctgtgatccttgc |
240 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
23467353 |
tgtggcgctggcgtggctgtgatccttgc |
23467325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University