View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21345_low_8 (Length: 260)
Name: NF21345_low_8
Description: NF21345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21345_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 248
Target Start/End: Original strand, 13877454 - 13877689
Alignment:
| Q |
16 |
gaagtgagttgccatgatggtcgtataatgtcagcagttgtcctggctttcctccgaggaatcgaacaccattct---tccccttgcaaatagcatgttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
13877454 |
gaagtgagttgccatgatggtcgtataatgtcagcagttgtcctggctttcctccgaggaattgaacaccattcttcttccccttgcaaatagcatgttt |
13877553 |
T |
 |
| Q |
113 |
atcaatataagtcgaatcaagcgaaacaaaattgtataatttggtccatccatttaatttatccatgacccaaattctcattctgatcataggatggtaa |
212 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13877554 |
atgaatataagtcgaatcaagcgaaacaaaattgtataatttggtccatccatttaatttatccatgacccaaattctcattctgatcataggatggtaa |
13877653 |
T |
 |
| Q |
213 |
cactgcacaacataagcaagggaaccgttcatctca |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13877654 |
cactgcacaacataagcaagggaaccgttgatctca |
13877689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University