View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21346_high_14 (Length: 249)
Name: NF21346_high_14
Description: NF21346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21346_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 5 - 146
Target Start/End: Original strand, 6903717 - 6903860
Alignment:
| Q |
5 |
agtgagatgaataatattc--agtttgaacggtgaacctataatcatttggtaaaatatttgctctcacgagcttctaatatctttcattaacttataac |
102 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| || ||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6903717 |
agtgagatgaataatattcgaagtttgaatggtaaaactatagttatttggtaaaatatttgctctcacgagcttctaatatctttcattagcttataac |
6903816 |
T |
 |
| Q |
103 |
aatttgtttgagacacttcaagttgtgtttgagcttaaacaaca |
146 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6903817 |
aatttgtttgagacactccaagttgtgtttgagcttaaacaaca |
6903860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University