View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21346_low_16 (Length: 245)
Name: NF21346_low_16
Description: NF21346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21346_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 56492391 - 56492171
Alignment:
| Q |
16 |
ctaatcctcccattactatgactatgatgatcatcatcatcaattcttgaacagtatcttctcactctcattacattacaaggaaacacaccaacactta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492391 |
ctaatcctcccattactatgactatgatgatgatcatcatcaattcttgaacagtattttctcactctcattacattacaaggaaacacaccaacactta |
56492292 |
T |
 |
| Q |
116 |
cacccctcatcgcattcatggcatggcatagcatggaaaccaaacaccaaatcaaatattatgttgttgtttcttttcaagttgcaactcctgtcttcag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492291 |
cacccctcatcgcattcatggcatggcatagcatggaaaccaaacaccaaatcaaatattatgttgttgtttcttttcaagttgcaactcctgtcttcag |
56492192 |
T |
 |
| Q |
216 |
tttagccacgtcactacccta |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
56492191 |
tttagccacgtcactacccta |
56492171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University