View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21346_low_4 (Length: 468)
Name: NF21346_low_4
Description: NF21346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21346_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 8e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 333 - 458
Target Start/End: Original strand, 52542946 - 52543071
Alignment:
| Q |
333 |
caatcgcgaaagacgatgttgtcgcctctttgagaaagtacgaagaactgagagatcatgtttgatttgctttgctttgcttgctgtgtttccttgttca |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52542946 |
caatcgcgaaagacgatgttgtcgcctctttgagaaagtacgaagaactgagagatcatgtttgatttgctttgctttgcttgctgtgtttccttgttca |
52543045 |
T |
 |
| Q |
433 |
actcaacgcattgtcttcaacctttg |
458 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52543046 |
actcaacgcattgtcttcaacctttg |
52543071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 121 - 214
Target Start/End: Original strand, 52542731 - 52542824
Alignment:
| Q |
121 |
caggtggagcatctccatcagcgtcttctttccagaatttaactttgcggaaaaatgtttcagcgcttcccttttggacttcaccacgatctgc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52542731 |
caggtggagcatctccatcagcgtcttctttccagaatttaactttgcggaaaaatgtttcagcgcttcccttttggacttcaccacgatctgc |
52542824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University