View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_high_50 (Length: 273)
Name: NF21347_high_50
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_high_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 260
Target Start/End: Complemental strand, 3468532 - 3468289
Alignment:
| Q |
17 |
cagtcgttgatccgcaaggcaaactcattggagaaatctcaccctttattttgaattcttgtgatgaaattgttgtccctgcaattgcaactctctcagc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3468532 |
cagtcgttgatccgcaaggcaaactcattggagaaatctcaccctttatgttgaactcttgtgatgaaattgatgtccctgcaattgcaactctctcagc |
3468433 |
T |
 |
| Q |
117 |
tggtgatctcttagcttacatcgactgcggtggtccaccggaggatttagttcagctggtaaaggagaggctgcatgagcagaatctcgacaacgcggct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3468432 |
tggtgatctcttagcttacatcgactgcggtggtccaccggaggatttagttcagctggtaaaggagaggctgcatgagcagaatctcgacaacgcggct |
3468333 |
T |
 |
| Q |
217 |
gtggagttacttggggagggatcagagctttcatcttggtcttc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3468332 |
gtggagttacttggggagggatcagagctttcatcttggtcttc |
3468289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University