View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_high_56 (Length: 255)
Name: NF21347_high_56
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_high_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 8255788 - 8256028
Alignment:
| Q |
1 |
atttctaccaatgtcatgcgctccaatcgggtcgaggcgcccccatgttgggtctgatacactacaaatacgnnnnnnnnatcatatggtagctagtcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
8255788 |
atttctaccaatgtcatgcgctccaatcgggtcgaggctcccccgtgctgggtctgatacactacaaatacgttttttttatcatatggtag----tcat |
8255883 |
T |
|
| Q |
101 |
cttggaatcactcttcatatgagaaacttgtgctctagcggagaaattcattagaggttgaattggtacacaacagaggtgttctcttcaaaaattgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8255884 |
cttggaatcactcttcatatgagaaacttgtgttctagcggagaaattcattagaggttgaattggtacacaacagaggtgttctcttcaaaaattgttg |
8255983 |
T |
|
| Q |
201 |
atgcctacttgtgattcttatctttgttatatcaattatgttctt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8255984 |
atgcctacttgtgattcttatctttgttatatcaattatgttctt |
8256028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University