View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_high_57 (Length: 255)
Name: NF21347_high_57
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_high_57 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 63 - 255
Target Start/End: Complemental strand, 27329646 - 27329463
Alignment:
| Q |
63 |
gagagcacaacattcaatatactttcctttctctcttcacagtctgcaacagccagcttgttgagtgcagaatttatacttttgtggcaacatttgtcca |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27329646 |
gagagcacaacattcaatatactttcctttctctcttcacagtctgcaacagccagcttattgagtgcagaatttatacttttgtggcaacatttgtcca |
27329547 |
T |
 |
| Q |
163 |
tgtctgagagcagtactatttagcaaatagacgtgttccctctacctctagtctattttctttgtattaactcatcacattttaggagaagtt |
255 |
Q |
| |
|
| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27329546 |
tttctgagagc---actatttagcaaatagacgtgttc------cctctagtctattttctttgtattaactcatcacattttaggagaagtt |
27329463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University