View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_high_69 (Length: 241)
Name: NF21347_high_69
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_high_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 36464326 - 36464109
Alignment:
| Q |
15 |
caagaacttccttcactccttttactatcaaatcctcttggcttggattctttgacaataaccaaagaagccatgtcattgccgccgacgtcgtgtctct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36464326 |
caagaacttccttcactccttttactatcaaatcctcttggcttggattctttgacaataaccaaagaagccatgtcattgccgccgacgtcgtgtctct |
36464227 |
T |
|
| Q |
115 |
ccctgccatgataaaactaataaccatatctctcaccatgatttcatcatgccctccttccaacaactttgtcaacaaatcactcccactaacattattt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36464226 |
ccctgccatgataaaactaataaccatatctctcaccatgatttcatcatgccctccttccaacaactttgtcaacaaatcactcccactaacattattt |
36464127 |
T |
|
| Q |
215 |
ctttcactaatttctttt |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36464126 |
ctttcactaatttctttt |
36464109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 29 - 232
Target Start/End: Complemental strand, 36474503 - 36474300
Alignment:
| Q |
29 |
actccttttactatcaaatcctcttggcttggattctttgacaataaccaaagaagccatgtcattgccgccgacgtcgtgtctctccctgccatgataa |
128 |
Q |
| |
|
|||||||| |||||||| ||||||| |||| ||||||||||||| ||||||||||| ||||||| | ||||||| | |||| |||||| | | ||||| |
|
|
| T |
36474503 |
actcctttcactatcaattcctctttgcttagattctttgacaacaaccaaagaagttatgtcatcgtcgccgacattgtgtttctccccgttaggataa |
36474404 |
T |
|
| Q |
129 |
aactaataaccatatctctcaccatgatttcatcatgccctccttccaacaactttgtcaacaaatcactcccactaacattatttctttcactaatttc |
228 |
Q |
| |
|
|| |||||| |||||||||| ||||| |||||||||||||| | || ||||||||||||| |||||||||||| | |||| |||| |||||| |||||| |
|
|
| T |
36474403 |
aaataataatcatatctctcgccatggtttcatcatgccctgcctctaacaactttgtcagcaaatcactcccgccaacaatattgttttcaccaatttc |
36474304 |
T |
|
| Q |
229 |
tttt |
232 |
Q |
| |
|
|||| |
|
|
| T |
36474303 |
tttt |
36474300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University