View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_high_76 (Length: 232)
Name: NF21347_high_76
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_high_76 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 223
Target Start/End: Original strand, 52576644 - 52576846
Alignment:
| Q |
21 |
attgtttcaaggattaagatagaacattatttcttagaagatgttgttatcttacagaatctccaagatgaacttcttgccaaattccaggggatatcca |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52576644 |
attgtttcaaggattaagagagaacattatttcttagaagatgttgttatcttacagaatctccaagatgaacttcttgccaaattccaggggatatcca |
52576743 |
T |
|
| Q |
121 |
aatgggccaccaattatggctgcatcatccattgtaacctcgtacactttcgggctactttttctgtcaagtaacaagatgtaaaaaatattcagttcat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52576744 |
aatgggccaccaattatggctgcatcatccattgtaacctcgtacactttcgggctactttttctgtcaagtaacaagatgtaaaaaatattcagttcat |
52576843 |
T |
|
| Q |
221 |
ctc |
223 |
Q |
| |
|
||| |
|
|
| T |
52576844 |
ctc |
52576846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University