View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21347_high_83 (Length: 225)

Name: NF21347_high_83
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21347_high_83
NF21347_high_83
[»] chr2 (1 HSPs)
chr2 (23-225)||(8255580-8255782)


Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 23 - 225
Target Start/End: Original strand, 8255580 - 8255782
Alignment:
23 gaaagaaacgacacatgaccttgtgtggtatcagaatcttcggcgttaatgttgggcaaaaacgccacactttcaaggctgaaagggcacttttctacac 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
8255580 gaaagaaacgacacatgaccttgtgtggtatcagaatcttcggcgttaatgttgggcaaaaacgccacactttcaaggctgaaagggcacttttctacaa 8255679  T
123 cgttaatgttgggcatcaaaatcttcagcgttgaatgctactcttcaggttcagggcgttaggcaccctagtagcagtgatgcactgtgatgttttccaa 222  Q
    |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||    
8255680 cgttaatgttgggcgtcaaaatcttcagtgttgaatgctactcttcaggttcagggtgttaggcaccctagtagcagtcatgcgctgtgatgttttccaa 8255779  T
223 ttt 225  Q
    |||    
8255780 ttt 8255782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University